Clara Listensprechen @ClaraListensprechen4@social.cleverlibre.org

A colleague apparently has Siri read his Slack messages to him. Earlier today he asked me for some oligo sequences and he reports that Siri trying to say "GCATTCGGGATATTAACGAGGC" is hilarious.

Construction on new central Saskatoon library delayed due to costs https://saskatoon.ctvnews.ca/construction-on-new-central-saskatoon-library-delayed-due-to-costs-1.6561932

Construction on Saskatoon's new downtown library has been delayed after bids for the project came in over its $134 million budget.

ICYMI: #News #TopStories Wisconsin’s elder care facilities face staffing, financial challenges that threaten care https://wausaupilotandreview.com/2023/09/12/wisconsins-elder-care-facilities-face-staffing-financial-challenges-that-threaten-care/?utm_source=dlvr.it&utm_medium=mastodon

Pelosi mocks McCarthy's 'ever incredibly shrinking speakership' - POLITICO

https://www.politico.com/news/2023/09/13/pelosi-mocks-mccarthys-ever-incredibly-shrinking-speakership-00115841

N. Korea reaches 'satisfactory agreement' with Russia at summit https://mainichi.jp/english/articles/20230914/p2g/00m/0in/016000c

ICYMI: #Milestones #afternoonupdate Today in History: September 12, Voyager 1 becomes first man-made object to leave the solar system https://wausaupilotandreview.com/2023/09/12/today-in-history-september-12-voyager-1-becomes-first-man-made-object-to-leave-the-solar-system/?utm_source=dlvr.it&utm_medium=mastodon

Russia's Vladimir Putin praises Elon Musk as an 'outstanding person'

https://www.cnbc.com/2023/09/12/russias-vladimir-putin-praises-elon-musk-as-an-outstanding-person.html

Tal día como hoy, en 1914, nace Robert S. Dietz, geofísico y oceanógrafo estadounidense que expuso una teoría sobre la expansión del fondo marino, clave para el desarrollo de la tectónica de placas.

https://buff.ly/3PpIQuC

McCarthy runs head first into conservatives' spending stonewall - POLITICO

https://www.politico.com/news/2023/09/13/kevin-mccarthy-spending-stonewall-00115581

Climate crisis

Earth ‘well outside safe operating space for humanity’, scientists find

Six out of nine “planetary boundaries” had been broken because of human-caused pollution and destruction of the natural world
https://www.theguardian.com/environment/2023/sep/13/earth-well-outside-safe-operating-space-for-humanity-scientists-find

#ClimateChange

Current #mood

Forgot, today is #Wrensday.
#birds #birdsofmastodon #birdphotography #naturephotography #nature #MastodonNatureCommunity #wildlife #wildlifephotography #birding #aves #fotografia

Trending hashtags on mastodon.social

Busted: Florida neo-Nazi arrested for hanging swastikas on overpass https://www.rawstory.com/florida-neo-nazi-arrested/?utm_source=dlvr.it&utm_medium=mastodon

#capybara

Capybara Fact: When capybaras are happy, they make a noise that sounds like purring.

14,039,582 accounts
+63 in the last hour
+6,223 in the last day
+29,600 in the last week

Apparently being online has made us all girls. Well OK then. https://www.wired.com/story/girls-online-culture/

To boldly go where no-one has gone before because they have more brains than I do. (Husband's contribution)

#DamnedIfIDoDamnedIfIDont #DamnedIfIDoDamedIfIDont
#HashtagGames